raw264 7 atcc cat (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC raw264 7 atcc cat
Raw264 7 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 24488 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/raw264+7+atcc+cat/RAW+264%2E7/pm41850230-455-84-85
Average 99 stars, based on 24488 article reviews

raw264 7 atcc cat - by Bioz Stars, 2026-10

99/100 stars

Images

Quantitative RT-PCR:

Article Title: Virulence factors perforate the pathogen-containing vacuole to signal efferocytosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Mouse macrophage-like cell: RAW264.7 ATCC CatTIB-71, RRID:CVCL_0493 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson Labs Cat#JAX:000664, RRID:IMSR_JAX:000664 Mouse: B6.129S4(C)-C5ar1tm1Cge/BaoluJ Jackson Labs Cat#JAX:033903, RRID:IMSR_JAX:033903 Oligonucleotides For qRT-PCR primers used in this study see Table S1 see Table S1 see Table S1 Software and algorithms Prism v8.0 GraphPad http://www.graphpad.com Microsoft Excel for Mac Microsoft N/A MacVector v15.5.4 MacVector https://macvector.com/ ImageJ (Fiji) NIH https://fiji.sc/ .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Mouse macrophage-like cell: RAW264.7 ATCC Cat#TIB-71, RRID:CVCL_0493 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson Labs Cat#JAX:000664, RRID:IMSR_JAX:000664 Mouse: B6.129S4(C)-C5ar1tm1Cge/BaoluJ Jackson Labs Cat#JAX:033903, RRID:IMSR_JAX:033903 Oligonucleotides For qRT-PCR primers used in this study see Table S1 see Table S1 see Table S1 Software and algorithms Prism v8.0 GraphPad http://www.graphpad.com Microsoft Excel for Mac Microsoft N/A MacVector v15.5.4 MacVector https://macvector.com/ ImageJ (Fiji) NIH https://fiji.sc/

Software:

Article Title: SENP1-Sirt3 signaling promotes α-ketoglutarate production during M2 macrophage polarization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Purified anti-mouse CD16/32 Biolgend Cat#101302; RRID: FITC anti-mouse CD206 Biolgend Cat# 141710;RRID: PE/Cy7 anti-mouse CD301 Biolgend Cat# 145706;RRID:AB_2562940 PerCP/Cy5.5 anti-mouse F4/80 Biolgend Cat#109828;RRID: APC anti-mouse CD11b Biolgend Cat# 101212;RRID:AB_312795 BV421 anti-mouse Ly-6G/Ly-6C(Gr1) Biolgend Cat# 108434;RRID:AB_2562219 PE anti-mouse CD170 Antibody Biolgend Cat# 155505;RRID:AB_2750234 InvivoMAb anti-mouse IL-4 BioXcell Cat# BE0045;RRID:AB_1107707 Anti F4/80 microbeads ultrapure, mouse Miltenyi Biotec Cat# 130-110-443 NOS2(C-11) Antibody Santa Cruz biotechnology Cat#sc-7271;RRID:AB_2891105 Acetylated-Lysine antibody Cell Signaling Technology Cat#9441;RRID:AB_331805 ChIPAb+ Trimethyl-Histone H3(Lys27) Millipore Cat#17-622; Anti-GLUD1 antibody Abcam Cat# ab168352; Sirt3 (D22A3) Rabbit mAb Cell Signaling Technology Cat#5490; RRID: AB_10828246 SENP1 antibody Abcam Cat#108981; RRID: AB_10862449 Anti-Mouse ATP5A Abcam Cat#110273; RRID: AB_10858175 Anti-mouse b-Actin (Actin) Abcam Cat# ab8227;RRID:AB_2305186 Anti-Goat Lamin B Santa Cruz Cat#sc-6216; RRID: AB_648156 Anti-Rabbit IgG HRP-linked CST Cat#7074P2; RRID: AB_2099233 Anti-Mouse IgG HRP-linked CST Cat#7076P2; RRID: AB_330924 IPKine HRP AffiniPure Goat Anti-Rabbit IgG light chain Abbkine Cat# A25022; RRID:AB_2893334 complete Protease Inhibitor Cocktail Tablets Roche Cat#11697498001 Chemicals, peptides, and recombinant proteins Murine IL-4 PeproTech Cat#214-14 Murine M-CSF PeproTech Cat#315-02 Murine IFNg PeproTech Cat#315-05 LPS (Lipopolysaccharides from Escherichia coli O111:B4) Sigma Cat#L4391 Phorbol 12-Myristate 13-Acetate (PMA) Sigma Cat#P8139 TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Etomixr Sigma Cat#E1905-5MG BPTES Sigma Cat#SML0601 dimetyl-alpha-ketoglutarate Sigma Cat#349631-5G Chitin Sigma Cat#C9213-500G U-13C5 Glutamine Cambridge Isotope Laboratories Cat#CLM-1822-H-PK Protein A/G Magnetic Beads ThermoFisher Scientific Cat#88802 Lipofectamine 3000 transfection reagent ThermoFisher Scientific Cat#L3000015 Critical commercial assays IL-1b Mouse Uncoated ELISA Kit ThermoFisher Scientific Cat#88-7013-88 IL-6 Mouse ELISA Kit ThermoFisher Scientific Cat#KMC0061 TNFa Mouse ELISA Kit ThermoFisher Scientific Cat#BMS607-3 IL-10 Mouse Uncoated ELISA Kit ThermoFisher Scientific Cat#88-7105-77 Seahorse XF calibrant solution Agilent Cat# 100840-100 Seahorse XF Cell Mito Stress Test Kit (OCR) Agilent Cat#103015-100 (Continued on next page) e1 Cell Reports 39, 110660, April 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm Fixation/Permeabilization Kit BD Bioscience Cat#554714 GLUD1 activity Assay Kit Abcam Cat#ab102527 Succinate Assay Kit Biovision Cat#K649 a-ketoglutarate Assay Kit Biovision Cat#K677 Deposited data RNAseq data GEO GSE195438 Glutamine flux data Metabolomics Workbench https://doi.org/10.21228/M81H6N Flowcytometry/Seahorse/WesternBlot/RT-PCR raw data Mendeley https://doi.org/10.17632/rt7y639j7 s.1 Experimental models: Cell lines Human: HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 Human: RAW264.7 ATCC Cat#SC-6003 Human:THP-1 ATCC Cat#TIB-202 Experimental models: Organisms/strains Lyz-Cre mice The Jackson Laboratory Cat# JAX:022071, RRID: IMSR_JAX:022071 Sirt3 knockout (Sirt3 KO) mice (Hallows et al., 2011) N/A Sirt3 K223R mice (Wang et al., 2019) N/A Senp1 flox/flox mice (Ferdaoussi et al., 2015); (Huang et al., 2019) N/A Recombinant DNA pcDNA3.1-GLUD1-WT-Flag This paper N/A pcDNA3.1-GLUD1-KR-Flag This paper N/A pcDNA3.1-GLUD1-KQ-Flag This paper N/A pCDH-GLUD1-WT-Flag This paper N/A pCDH-GLUD1-KR-Flag (K211/346/352/503R) This paper N/A pCDH-GLUD1-KQ-Flag (K211/346/352/503Q) This paper N/A pCDH-Sirt3 WT-Flag (Wang et al., 2019) N/A pCDH-Sirt3 KR-Flag (Wang et al., 2019) N/A Oligonucleotides Mouse shGlud1 AATAACTCATTTGAGGACCT N/A Human shSIRT3 CAACGTCACTCACTACTTT N/A Software and algorithms FlowJo v.10.CL FlowJo https://www.flowjo.com/ Prism v.7.0e GraphPad http://www.graphpad.com Other Seahorse XFe96 Extracellular Flux Analyzer Agilent Technologies N/A BD FACSVerseTM BD Biosciences N/A ..

other:

Article Title: Macrophage K63-Linked Ubiquitination of YAP Promotes Its Nuclear Localization and Exacerbates Atherosclerosis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER siRNA-IRAK1 Santa Cruz Biotechnology Cat#sc-35705 siRNA-TAK1 Santa Cruz Biotechnology Cat#sc-36607 siRNA-TRAF6 Santa Cruz Biotechnology Cat#sc-36718 siRNA-Control Santa Cruz Biotechnology Cat#sc-37007 MG132 MCE Cat#HY-13259 CHX MCE Cat#HY-12320 Anakinra McKesson N/A Anti-MCP1 antibody Abcam Cat#ab25124, RRID:AB_448636 Histopaque-1077 Sigma-Aldrich Cat#SD10771A Collagenase Type XI Sigma-Aldrich Cat#C7657 Hyaluronidase Type 1 Sigma-Aldrich Cat#H3506 DNAase I Sigma-Aldrich Cat#D5025 Collagenase I Sigma-Aldrich Cat#C0130 RIPA buffer Solarbio LIFE SCIENCES Cat#R0010 Native lysis buffer Solarbio LIFE SCIENCES Cat#R0030 Cocktail Roche Cat#04693132001 PhosSTOP Roche Cat#04906845001 Protein A/G PLUS-Agarose beads ThermoFisher Cat#20423 Anti-Flag magnetic beads Bimake Cat#B26101 Pierce 3x DYKDDDDK Peptide ThermoFisher Cat#A36805 Lipofectamine RNAi MAX transfection reagent ThermoFisher Cat#13778150 Neomycin Sigma-Aldrich Cat#N6386 Polymyxin B sulfate Sigma-Aldrich Cat#5291 Critical Commercial Assays CCL2 elisa kit Elabscience Biotechnology Cat#SEA087Mi IL-1b elisa kit Elabscience Biotechnology Cat#E-EL-H0149c human YAP elisa kits Abcam Cat#ab230942 QIAGEN RNeasy Mini Kit QIAGEN Cat#74104 NE-PER nuclear and cytoplasmic extraction Reagents ThermoFisher Cat#78833 TG BioSino Bio-Technology and Science Cat#20162400911 LDL-C BioSino Bio-Technology and Science Cat#20162400518 HDL-C BioSino Bio-Technology and Science Cat#20162400513 ECL western blotting detection kit ThermoFisher Cat#34580 Cytofix/Cytoperm Fixation/Permeabilization BD Cat#554715 SuperScript III and random primers ThermoFisher Cat#12574035 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat#V4XC-2024 Experimental Models: Cell Lines HEK293 ATCC Cat#CRL-11268 HeLa ATCC Cat#CCL-2 RAW264.7 ATCC Cat#TIB-71 Experimental Models: Organisms/Strains Mouse: Apoe / Vital River Laboratory Animal Technology Jackson 002052 Mouse: C57BL/6J Vital River Laboratory Animal Technology Jackson 000664 Mouse: LysMcre-YapKD (Wang et al., 2017) N/A Mouse: LysMcre The Jackson Laboratory Jackson 004781 Mouse: YapTg-flox (He et al., 2018) N/A (Continued on next page) e2 Cell Reports 32, 107990, August 4, 2020

Article Title: In situ chemoproteomic profiling reveals itaconate inhibits de novo purine biosynthesis in pathogens.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Casamino acids VWR Cat# J851-100G Succinate Sigma-Aldrich Cat# S3674 Malate Sigma-Aldrich Cat# 02288 Fumarate Sigma-Aldrich Cat# 47910 AMP Sigma-Aldrich Cat# A2252 Fetal bovine serum (FBS) Gibco Cat# 10099-141C Penicillin and streptomycin (P/S) Gibco Cat# 15140-122 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat# C11995500CP Opti-MEMTM I Reduced Serum Medium Gibco Cat# 31985070 Gentamicin Sigma-Aldrich Cat# G1264 PageRulerTM Prestained Protein Ladder, 10 to 180 kDa Thermo Fisher Scientific Cat# 26616 Precision Plus Protein Dual Color Standards Bio-Rad Cat# 1610374 Critical commercial assays PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 KOD OneTM PCR Master Mix -Blue- TOYOBO Cat# KMM-201 KOD -Plus- Mutagenesis Kit TOYOBO Cat# SMK-101 Glutamate-GloTM Assay Promega Cat# J7021 NAD/NADH-GloTM Assay Promega Cat# G9071 QIAGEN Plasmid Mini Kit QIAGEN Cat#12125 HiPure Gel Pure Micro Kit Magen Cat# D2110-02 ClonExpress II One Step Cloning Kit Vazyme Cat# C112-02 X-tremeGENETM 9 Roche Cat# 6365779001 PierceTM ECL Western Blotting Substrate Thermo Fisher Scientific Cat# 32209 Immobilon Western Chemiluminescent HRP Substrate Millipore Cat# WBKLS0100 Deposited data MS Raw data iProx PXD050510 Experimental models: cell lines Mouse: Raw264.7 ATCC Cat#TIB-71 Mouse: Raw264.7 IRG1 / This study N/A Experimental models: organisms/strains Staphylococcus aureus FPR3757 Renji Hospital, School of Medicine, Shanghai Jiaotong University N/A Pseudomonas aeruginosa PAO1 University of Chinese Academy of Sciences N/A Salmonella Typhimurium SL1344 ATCC Cat# 14028 Salmonella Typhimurium SL1344 DguaB This study N/A Salmonella Typhimurium SL1344 DpurF This study N/A Salmonella Typhimurium SL1344 DICL This study N/A Oligonucleotides oligonucleotides This study Table S4 Recombinant DNA Plasmid: pET21b-guaB-His6 This study N/A Plasmid: pET21b-guaB-His6 C305A This study N/A Plasmid: pET21b-guaC-His6 This study N/A Plasmid: pET21b-guaC-His6 C186A This study N/A Plasmid: pET21b-guaA-His6 This study N/A (Continued on next page) 12 Cell Reports 43, 114737, September 24, 2024

Article Title: cGAS and DDX41-STING mediated intrinsic immunity spreads intercellularly to promote neuroinflammation in SOD1 ALS model.
Article Snippet: RAW264.7 ATCC Cat#TIB-71; RRID: CVCL_0493 SH-SY5Y ATCC Cat#CRL-2266; RRID: CVCL_0019 Neuro2a ATCC Cat#CCL-131; RRID: CVCL_0470 SIM-A9 ATCC Cat#CRL-3265; RRID: CVCL_5I31 HASTR/ci35 From Dr. Tomomi Furihata (TUPLS, Japan) Cat#N/A; RRID: CVCL_4U69; (Furihata et al., 2016; Kitamura et al., 2018) C20 From Dr. David Alvarez- Carbonell (CWRU, USA) Cat#N/A; RRID: N/A; (Garcia-Mesa et al., 2017) NSC-34 From Dr. Neil R. Cashman (UBC, Canada) Cat#N/A; RRID: CVCL_D356; (Cashman et al., 1992) MO3.13 From Dr. Neil R. Cashman (UBC, Canada) Cat#N/A; RRID: CVCL_D357; (McLaurin et al., 1995)

Article Title: Macrophage K63-Linked Ubiquitination of YAP Promotes Its Nuclear Localization and Exacerbates Atherosclerosis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for qRT-PCR, see Table S2 This paper N/A Mouse AMOT siRNA, forward (50-30) GenePharma N/A Forward:CCAGCACUCUGGAAAGAATT Mouse AMOT siRNA, reverse (50-30) Reverse:UUUCUUUCCAGAGUGCUGGTT Recombinant DNA p-CMV-Flag-YAP1 Addgen Cat#66853 p-CDNA3.1-Myc-TRAF6 (Jiao et al., 2015) p-CDNA3.1-Myc-TRAF6 p-CMV-Flag-YAP1-K252R Songon Biotch N/A p-CDNA3.1-Myc-TRAF6C70A (Jiao et al., 2015) p-CDNA3.1-Myc-TRAF6C70A p-RK5-HA-Ubiquitin-K63 (Li et al., 2017) Cat#17606 p-RK5-HA-Ubiquitin-K48 (Li et al., 2017) Cat#17605 p-RK5-HA-Ubiquitin (Li et al., 2017) p-RK5-HA-Ubiquitin p-CDNA3.1-HA-AMOT (Zhao et al., 2011) p-CDNA3.1-HA-AMOT Software and Algorithms Prism Graphpad https://www.graphpad.com/ ImageJ NIH https://imagej.en.softonic.com/ Image-Pro NIH https://imagej.nih.gov/ij FlowJo BD https://www.flowjo.com/

Enzyme-linked Immunosorbent Assay:

Article Title: Blood-brain barrier-penetrative lipid nanoparticles enable systemic delivery of TRIM11 mRNA to disaggregate Tau in Alzheimer's disease models.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays TransStart FastPfu DNA Polymerase TRAN Cat#AP221-12 Mouse tumor necrosis factor-α (TNF-α) ELISA kit Gelatins Cat#JLC-R13963 Mouse interleukin-6 (IL-6) ELISA kit Gelatins Cat#JLC-R13878 Mouse interleukin-1β (IL-1β) ELISA kit Gelatins Cat#JLC-R13796 Mouse interleukin-10 (IL-10) ELISA kit Gelatins Cat#JLC-R13907 HisScribe T7 mRNA Kit NEWENGLAND Biolabs Cat#E2080 Total RNA Extraction Kit Solarbio Cat#R1200 Experimental models: Cell lines Mouse: Neuro2A ATCC Cat#CCL-131TM Human: U87-MG This paper N/A Mouse: BV2 This paper N/A Human: SH-SY5Y ATCC Cat#CRL-2266TM Mouse: bEnd.3 ATCC Cat#CRL-2299TM Mouse: RAW264.7 ATCC CatTIB-7TM Human: HEK293T Procellsystem Cat#CL-0005 Human: Human Astrocytes Procellsystem Cat#CP-H122 Human: Hela ATCC Cat#CRM-CCL-2TM Experimental models: Organisms/strains 3×Tg-AD mice Shulaibao (Wuhan) Biotechnology Co., Ltd. N/A C57BL/8M mice SPF (Beijing) Biotechnology Co.Ltd. .. N/A Oligonucleotides qRT-PCR primers Sangon see Table S1 PCR primers Sangon see Table S1 mRNA sequences NCBI see Table S2 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ GraphPad Prism 8.0 Graphpad https://www.graphpad.com/ FlowJo software v10.6.2 FlowJo https://www.flowjo.com Living Image software Caliper Life Sciences www.caliperls.com ZEN Microscopy Software Zeiss https://www.zeiss.com.cn/ SnapGene SnapGene https://www:snapgene.com CytExpert software v1.0 Beckman https://www.beckman.com/flow cytometry/research-flow cytometers/ cytoflex/software Other EcoR1 NEWENGLAND Biolabs Cat#R0101S Xho1 NEWENGLAND Biolabs Cat#R0146S Xba1 NEWENGLAND Biolabs Cat#R0145S PVDF membranes Millipore Cat#IPVH00010 96-well plates Falcon® Cat#3300 96-well black plates LABSELECT Cat#31112 e2 Cell Reports Medicine 7, 102685, March 17, 2026 Culture Collection (ATCC).

Review

raw264 7 atcc cat (ATCC)

Structured Review

Images

Related Articles

Quantitative RT-PCR:

Software:

other:

Enzyme-linked Immunosorbent Assay:

RNA Extraction:

Activity Assay:

RNA sequencing:

Knock-Out:

Recombinant:

Similar Products

Image Search Results